The adsorption, coagulation and chemical oxidation. This

The biological methods of phenol removal from the contaminated environment such as wastewater has been more successful than the former physiological and chemical methods due to its low cost, efficient, saves energy and it exhibits characteristics of preventing secondary pollution (Gu, Wu et al. 2017). Appart from biological method of phenol removal, different types of techniques and methods have been in existence for the phenol removal from the contaminated environment or wastewater. These methods or techniques are solvent extraction and adsorption, coagulation and chemical oxidation.

This methods has disadvantage because its cost is high, risk to health of the workers and they are not friendly to environment because of the production of toxic secondary intermediates (Hamedo, El-Shamy et al.). The isolated phenol degrading-bacteria was screened for its ability to degrade phenol and we confirmed that strain 119-2 was able to effectively degrade 95.7 percent of the phenol present in the sample.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

The isolates were adopted as Kocuria rosea bacteria (strain 119-2) from the phenol contaminated Qinhai river. The isolates of strain 119-2 were done using MSM and supplementing the media with phenol as the sole of carbon source for phenol degradation. The isolated strain of 119-2 was subjected for identification through morphological and biochemical characteristics. Identification of the strain 119-2 was done through simple gram staining which shows that these phenol degrading isolates are gram-positive, spore-forming, cocci and orange in colour.

Biochemical characteristics test was done which includes ONPG hydrolysis, Ornithine decarboxylases, Lysine decarboxylases, Urease, melanin, catalase, Phenylalanine deamination, Methyl red, Nitrate reduction,Tryptophan deamination (Indole), malanote, Hydrogen sulfide production, Esculin hydrolysis, Esculin hydrolysis, xylose, Adonitol, Glucose, Rhamnose, Arabinose, Lactose , Araffinose , Saccharose, Trehalose, cellobiose, oxidase  and melibiose. This test shows that the strain 119-2 have similar characteristics with Kocuria rosea (PDM-7) strain following the comparison through a biochemical test. Moreover, the isolated strain 119-2 were subjected to growth after incubation at 250C, 300C, 37 0C and 40 0C in LB media and it were observed in OD600 in every 10hrs to 120hrs.

The results revealed that the strain 119-2 indicated that bacteria (strain 119-2) grows very well at 250C, 300C and 37 0C showing optimum temperature while at 400C, the bacteria was unable to the survive and could not grow. This shows that biodegradation depends on the environmental factors known as temperature and pH level (Duan 2011). It proved that strain 119-2 posess the capacity to grow effectively at different pH level such as pH 7, pH8, pH 9 in 3 to 4days while at pH 9, strain 119-2 were seen growing very fast within 2days and pH 7, pH8 was growing at same rate within 4days.

The acidity or basicity cannot enter the cell easily due to the fact that they exist in undissociated form and in a condition that does not stop them from getting to the cells. It was also suggested that the pH level for phenol degradation is 7 for some bacterias. However,  the temperature is one of the factors that plays a perfect role in biodegradation and most laboratory researchers have recommended that phenol degradation should be carried out on an optimum temperature of 300C (Basha, Rajendran et al. 2010).

According to our research, it showed that microorganism requires the variable content of salt concentration for effective growth and metabolism. The salt requirement is not an exclusive need for sodium chloride because many halophiles require a low level of potassium ions, magnesium ions including anions and cations together with NaCl. Moreover, strain 119-2 is an alkaliphilic and mesophilic bacteria due to its characteristics of growing in a high percentage of salt and for this reason, there is no specific NaCl and other sugars can be substituted (Abdulkarim, Fatimah et al.

2009). Following the acclamation for 270hrs of strain 119-2 using LB media, strain 119-2 was able to grow perfectly well in 0%, 2%, 4%, 6% of salt containg 100ML in the flask.  7% were seen growing but so slowly and at the very late stage followed by 8% which grows very slow and 9% were shown little growth effect. In 2%, 4%, 6% and 7% of salt , it started with inhibition at initial stage and we, therefore recommends that phenol degradation with strain 119-2 is best from 0% to 7% in salinity environments.

The pH factor in biodegradtion has contributed positively because bacteria grows at different acididy and alkalinity level and our results were analyzed through OD600 for 120hrs (5days) and it proved that strain 119-2 have the capacity to grow effectively in the following pH level such as pH 7, pH8, pH 9 in 3 to 4days. Where as in pH 9, strain 119-2 were seen growing very fast in 2 days and in  pH 7, pH8 was growing at same rate within 4days. The pH 5, pH 6, pH 10 and pH 11 strain 119-2 were found unable to grow effcetively and it afftects the biodegradation of  phenol because of its inhibition potentials. Moreover, pH 7, pH8 and pH 9 exhibits the optimum phenol degradation.

The identification of strain 119-2 through phylogenetic analysis based on 16SrRNA was done as part of the vital roles of 16SrRNA have performed in the area of microbiology and other disciplines such as ecology and taxonomy in the identification of isolated microorganism (Chun, Lee et al. 2007). For the sequence, DNA of the isolated bacteria was extracted using the general protocol of MO BIO laboratory directives after one-night of cultured the isolates. PCR amplification was carried out based on amplification of 16SrRNA of strain 119-2 using a universal primer 27F and 1242R.

The gene sequence showed that 16SrRNA 27F  (5’AGAGTTTGATCCTGGCTCAG 3 ‘) and 1492R (5′ AAGGAGGTGATCCAGCCGCA 3’) and the PCR purified product were sequenced.  The identified 16S rDNA gene sequences (1386bp) was also done using BLAST network service at the National Center for Biological information website www.ncbi.bim.nih.gov/BLAST).

CONCLUSIONPhenol is the commonest chemical used in different types of industry and is a very dangerous chemical to human life. Therefore, there is a need to properly treat the effluent or wastewater from these industries before discharging them to the environment because even at low concentration constitutes a public health threat to human and animal life. In this research, the identification of bacteria strain is known as kocuria rosea from Qinghai river that is capable of degrading phenol from wastewater was successfully studied and the identified strain was termed strain 119-2. The Strain 119-2 were subjected to different temperature, pH and salt concentration so as to checkmate its growth activities and it shows that they have the great effect on the biodegradation potentials. Moreover, the Biological method of phenol removal has been recognized as the most effective techniques of bioremediation of phenol-contaminated environments because it is affordable, easy to operate and it does not result to secondary pollution like physiological and chemical methods are prone to do so.

The identification of strain 119-2 through phylogenetic analysis based on 16SrRNA was done and it shows that strain 119-2 is familiar with Kocuria rosea.

x

Hi!
I'm Gerard!

Would you like to get a custom essay? How about receiving a customized one?

Check it out