Materials and MethodsPatient samples and therapiesThis study looked at 164 patients with acute lymphoblastic leukemia, diagnosed between June 2008 and June 2016, at our institutes. All 164 patients (107 B-cell and 57 T-cell ALL), ages 12-77 years old, were enrolled in the cohort study, with diagnoses based on the WHO Diagnosis and Classification of ALL (2008). As controls, 19 normal bone marrow samples were used. The written informed consent in accordance with the Declaration of Helsinki was provided to all patients before enrollment.

As previously published (CALLG2008) 18, the patients received VDCLP scheme, which consists of Vincristine (V), Daunorubicin (D), Cyclophosphamide (C), L- Asparaginase (L), and Prednisone (P), or CAT scheme, which contains C, Cytarabine (A) and Thioguanine (T), and high-dose Mitoxantrone, methotrexate/L-Asparaginase for induction or early induction. For late consolidation, VDLP or the combined therapy of Cyclophosphamide, Vincristine, Cytarabine, Epipodophyllotoxin and Dexamethasone (CVCED), high-dose Methotrexate/L-Asparaginase, Epipodophyllotoxin, and Cytarabine were utilized. Lastly, 6-Mercaptopurine and Methotrexate were used during maintenance therapy. Imatinib was also added to regimens for patients with BCR/ABL1-positive ALL starting on day 15 of introduction therapy.The Ethics Committee of Southeast University Zhongda Hospital and the Nanjing Medical University, Nanjing, China approved this study. Cytogenetic and molecular analysesDetection of Ikaros 6 (Ik6), the most common expression product from the IKZF1 deletion, and cytogenetics were performed as described 19.

For real-time PCR (qPCR), the StepOne Plus Real-time PCR system (Applied Biosystem-Thermofisher, Foster, CA, USA) was utilized. Patients were separated into different groups, based on those with high ARID5B expression and those with low (4th quartile vs. 1st-3rd quartiles), using a cut-off value determined by SPSS 20.0. Expression values of our genes of interest (GOI), ARID5B or PHF2, were identified in each sample by a formula as previously described 15-20. The formula was determined from a scatter graph of Ct values, derived from serial dilutions of a template standard. ARID5B expression level was normalized to housekeeping gene 18s rRNA expressed as gene expression value of ARID5B/18s rRNA.

The qPCR assay was also use to analyze ARID5B mRNA levels in Nalm6, CEM cells, and primary ALL cells, primers for the qPCR are: 18s rRNA, Sense: 5′-GTAACCCGTTGAACCCCATT-3′, Anti-sense: 5′- CCATCCAATCGGTAGTAGCG-3′; ARID5B Sense: 5′- TCTTAAAGGCAGACCACGCAA -3′, Anti-sense: 5′- TGCCATCGGAATTGTTGTTGG -3′. Results in drug treatment, Ikaros overexpression, or IKZF1 knockdown were normalized to those obtained with 18s rRNA and presented as fold-induction over DMSO or vector controls. Cell culture, plasmids and retroviral gene transfer The Nalm6 cell line has been previously described 21 and verified by the American Type Culture Collection (ATCC, Manassas, VA). The CCRF-CEM (CEM) and HEK 293T cell lines were obtained from ATCC.

HEK 293T cells were cultured in DMEM (Cellgro, Tewksbury, MA, USA) and supplemented with 10% fetal calf serum and 1% L-glutamine (Cellgro, Tewksbury, MA, USA). Nalm6, CEM, and primary human B-/T-ALL cells were cultured in RPMI-1640 medium (Cellgro, Tewksbury, MA, USA) and supplemented with 10% fetal bovine serum (Hyclone, Logon, Utah, USA). Cells were incubated at 37°C in a humidified atmosphere with 5% CO2. CX-4945 was obtained from Selleckchem (S2248, Houston, USA). Cells were cultured with or without CX-4945 and collected for total RNA isolation as well as western blot. Human IKZF1 retroviral construct, retroviral production, and retroviral infection of the cells were as previously described 15,21,23.

Luciferase AssayLightSwitch luciferase reporter constructs for promoters of ARID5B were purchased from SwitchGear Genomics. The transfection-ready promoter plasmid, or pLightSwitch-Rom vector, was transfected with Ikaros in pCDNA3.1 vector or vector only into HEK293 cells and the transient luciferase assay was done in the absence or presence of 10?M CX-4945 according to Switchgear Genomics manual by a luminometer. Luciferase activity was normalized as fold change relative to values obtained from pLightSwitch-Rom vector only control cells. Ikaros effect on the promoter activity was expressed as a percentage of pcDNA3.1-Ikaros transfection-induced luciferase activity versus that of pcDNA3.1 vector. The graphed data were the average of triplicates representative of one of 3 independent experimentsWestern Blot assayCells were treated with different doses of CX-4945 and DMSO as controls, and nuclear extracts were then obtained.

The ARID5B protein expression was detected by western blot with anti-ARID5B antibody (ab226776, Abcam, Cambridge, MA, USA) and Lamin B was detected by anti-Lamin B1 antibody (VPA00119, Bio-Rad, USA) as a loading control. Nuclear extraction and Western blot were performed as described previously 2,3. Quantitative Chromatin Immune precipitation (qChIP) Chromatin from cells that were treated with CX-4945 was incubated with antibodies against Ikaros 14,15, H3K4me3 (ab8580, Abcam, Cambridge, MA, USA) or normal rabbit IgG (ab171870, Abcam, Cambridge, MA, USA) as a control 14,15,32 for the qChIP assay. Enrichment of the ChIP sample over input was evaluated by qPCR with specific primers in the promoter region of ARID5B (forward: 5′- GCAGTCGCTGTCCGTTCAA -3′, reverse: 5′- CAAGTGAGCAGTGCACACACA -3′). For each qPCR assay, the experiment was performed in triplicate. Relative concentration of the qPCR product is presented as the fold change of the level of DNA-Ikaros and DNA-H3K4me3 samples compared with rabbit IgG controls.

IKZF1 shRNA knockdownHuman IKZF1 shRNA constructs in the GFP vector (pGFP-v-RS) purchased from OriGene (Rockville, MD, USA) and transiently transfected into Nalm6 and CEM cells using the Neon Transfection System (Invitrogen, Carlsbad, CA, USA). The cells transfected with a scrambled shRNA (29-mer) vector were used as a control. Ikaros level was evaluated in the cells by qPCR with IKZF1 specific primer 5′-GGCGCGGTGCTCCTCCT-3′ (IKZF1-F) and 5′-TCCGACACGCCCTACGACA-3′ (IKZF1-R) 15,23. Statistical analysesMedian differences between the cohorts were tested utilizing a Mann–Whitney U-test.

The uni- and multivariate Cox models were used for statistical analysis of frequency differences. The Kaplan-Meier method was performed to estimate the significance for the relapse-free survival (RFS) and overall survival (OS) with log-rank test. The date of diagnosis was the starting point for observation time for OS, and RFS was started at the time of declared remission to that of patients achieving complete remission (CR).

Living patients were censored for survival at follow up. SPSS version 20.0 was used for statistical analyses. Data were represented as a mean value with the standard error of the mean (SEM). Student t-test or analysis of variance (ANOVA) were used to determine the statistical significance for comparisons of two groups or comparing multiple groups, respectively.